Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19774050

Xenopus ORFeome
What is the ORFeome?

ORF Name:tbxt ORF1 Species: tropicalis
Gene Symbol: tbxt Entrez Gene ID: 493501
Gene Synonyms: bra, brachyury, ntl, t, t-a, t-b, x-bra, xbra, xbrachyury
Gene Name: T-box transcription factor T
Description: nuclear transcription factor
Plate: GDExt11019 Well: A12
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG134333.1
ORF Translation: ATO95685.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis T, brachyury homolog, mRNA (cDNA clone MGC:89607 IMAGE:6995163), complete cds
Template Accession: BC081350
GI: 51703994
Clone ID: IMAGE:6995163
Tissue: whole organism
Stage: NF stage 14 to NF stage 19
Clone Library: NICHD_XGC_Emb6
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGTGTAAGTGCCACCGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGATTGACGGCGGTGCAACT


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.4


Major funding for Xenbase is provided by grant P41 HD064556