Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19774060

Xenopus ORFeome
What is the ORFeome?

ORF Name:tcf21 ORF1 Species: tropicalis
Gene Symbol: tcf21 Entrez Gene ID: 100126209
Gene Synonyms: capsulin, epicardin, pod 1, pod1
Gene Name: transcription factor 21
Description: helix-loop-helix transcription factor
Plate: GDExt11048 Well: C11
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG136671.1
ORF Translation: ATO98023.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis transcription factor 21, mRNA (cDNA clone MGC:181149 IMAGE:8902620), complete cds
Template Accession: BC153711
GI: 157423353
Clone ID: IMAGE:8902620
Tissue: spleen
Stage:
Clone Library: NICHD_XGC_tropSp1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCACCGGTTCTCTC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATGATGCCGTGGGACCACACAA


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556