Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19774201

Xenopus ORFeome
What is the ORFeome?

ORF Name:thap1 ORF1 Species: tropicalis
Gene Symbol: thap1 Entrez Gene ID: 448407
Gene Synonyms:
Gene Name: THAP domain containing, apoptosis associated protein 1
Description:
Plate: GDExt11015 Well: D01
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG133885.1
ORF Translation: ATO95237.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis THAP domain containing, apoptosis associated protein 1, mRNA (cDNA clone MGC:89363 IMAGE:6988327), complete cds
Template Accession: BC075499
GI: 49522455
Clone ID: IMAGE:6988327
Tissue: whole organism
Stage:
Clone Library: NICHD_XGC_Emb5
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGCAATCGTGCTCGGCT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACAGAATGATTTCTTTATATGTTAT


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556