Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19774351

Xenopus ORFeome
What is the ORFeome?

ORF Name:tmed1 ORF1 Species: tropicalis
Gene Symbol: tmed1 Entrez Gene ID: 734138
Gene Synonyms: xp24g1, xp24gamma1
Gene Name: transmembrane p24 trafficking protein 1
Description: Membrane trafficking protein, emp24/gp25L/p24 family
Plate: GDExt11031 Well: H07
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG135256.1
ORF Translation: ATO96608.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis transmembrane emp24 domain containing 1, mRNA (cDNA clone MGC:146643 IMAGE:7660000), complete cds
Template Accession: BC123004
GI: 114107665
Clone ID: IMAGE:7660000
Tissue: brain
Stage: frog
Clone Library: NIH_XGC_tropBrn3
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTTGGTCAAGCAGCTTC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGTCCGGATCTTGCGCTT


Publications
First:
Most recent:
View All Papers