Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19774966

Xenopus ORFeome
What is the ORFeome?

ORF Name:trit1 ORF1 Species: tropicalis
Gene Symbol: trit1 Entrez Gene ID: 496761
Gene Synonyms:
Gene Name: tRNA isopentenyltransferase 1
Description: tRNA processing
Plate: GDExt11025 Well: B04
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG134783.1
ORF Translation: ATO96135.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis tRNA isopentenyltransferase 1, mRNA (cDNA clone MGC:108285 IMAGE:7021048), complete cds
Template Accession: BC088030
GI: 56789099
Clone ID: IMAGE:7021048
Tissue: whole organism
Stage:
Clone Library: NICHD_XGC_Swb1N
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGCGCAGGGCTT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATGCTGCTTCTTCTTCATCTTCATT


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556