Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19775176

Xenopus ORFeome
What is the ORFeome?

ORF Name:tuba4a ORF1 Species: tropicalis
Gene Symbol: tubal3.1 Entrez Gene ID: 407878
Gene Synonyms: tuba1, tuba4a
Gene Name: tubulin alpha like 3, gene 1
Description: microtubule component
Plate: GDExt11007 Well: G01
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG133189.1
ORF Translation: ATO94541.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis tubulin, alpha 4, mRNA (cDNA clone MGC:69264 IMAGE:5308252), complete cds
Template Accession: BC067974
GI: 45709762
Clone ID: IMAGE:5308252
Tissue: whole organism
Stage: NF stage 10 to NF stage 13
Clone Library: NICHD_XGC_Emb5
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGAGAATGCATATCTGTCC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTATTCATCCTCCTCATCTTC


Publications
First:
Most recent:
View All Papers