Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19775201

Xenopus ORFeome
What is the ORFeome?

ORF Name:tubb4b ORF1 Species: tropicalis
Gene Symbol: tubb4b Entrez Gene ID: 779904
Gene Synonyms: oocyte tubulin, tubb2, tubb2c, xlot
Gene Name: tubulin beta 4B class IVb
Description: microtubule component
Plate: GDExt11037 Well: E08
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG135714.1
ORF Translation: ATO97066.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis tubulin, beta 2C, mRNA (cDNA clone MGC:147611 IMAGE:7865339), complete cds
Template Accession: BC121707
GI: 113197768
Clone ID: IMAGE:7865339
Tissue: oviduct
Stage:
Clone Library: NIH_XGC_tropOvi1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGGGAAATCGTGCATC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATGCATTTTCCTCCTCTTCCCCT


Publications
First:
Most recent:
View All Papers