Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19775456

Xenopus ORFeome
What is the ORFeome?

ORF Name:ubqln4 ORF1 Species: tropicalis
Gene Symbol: Entrez Gene ID:
Gene Synonyms:
Gene Name:
Description:
Plate: GDExt11024 Well: H09
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG134760.1
ORF Translation: ATO96112.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis ubiquilin 4, mRNA (cDNA clone MGC:108243 IMAGE:7017381), complete cds
Template Accession: BC096013
GI: 66365723
Clone ID: IMAGE:7017381
Tissue: whole organism
Stage: frog
Clone Library: NICHD_XGC_Swb1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGAGAGCGGCGCT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGAGGGCTGGGAGCCCAA


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556