Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19775691

Xenopus ORFeome
What is the ORFeome?

ORF Name:vdac1 ORF1 Species: tropicalis
Gene Symbol: vdac1 Entrez Gene ID: 549246
Gene Synonyms:
Gene Name: voltage-dependent anion channel 1
Description: Porin/voltage-dependent anion-selective channel protein
Plate: GDExt11047 Well: C05
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG136550.1
ORF Translation: ATO97902.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis voltage-dependent anion channel 1, mRNA (cDNA clone MGC:146988 IMAGE:7883008), complete cds
Template Accession: BC127348
GI: 119850674
Clone ID: IMAGE:7883008
Tissue: spleen
Stage:
Clone Library: NIH_XGC_tropSpl1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCATACCTCCGGCATATGCT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATGCTTCAAATTCCAGTCCTAGACC


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556