Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19775841

Xenopus ORFeome
What is the ORFeome?

ORF Name:wac ORF1 Species: tropicalis
Gene Symbol: wac Entrez Gene ID: 496589
Gene Synonyms: ba48b24, ba48b24.1, bm-016, pro1741
Gene Name: WW domain containing adaptor with coiled-coil
Description:
Plate: GDExt11020 Well: F06
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG134317.1
ORF Translation: ATO95669.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis WW domain containing adaptor with coiled-coil, mRNA (cDNA clone MGC:89533 IMAGE:6993157), complete cds
Template Accession: BC084997
GI: 54648029
Clone ID: IMAGE:6993157
Tissue: whole organism
Stage: NF stage 14 to NF stage 19
Clone Library: NICHD_XGC_Emb6
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTAATGTATGCAAGGAAACAA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACACCATGAAGGAATTCTGGTT


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.0


Major funding for Xenbase is provided by grant P41 HD064556