Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19775856

Xenopus ORFeome
What is the ORFeome?

ORF Name:washc1 ORF1 Species: tropicalis
Gene Symbol: washc1 Entrez Gene ID: 549608
Gene Synonyms: wash1
Gene Name: WASH complex subunit 1
Description: Growth factor receptor-bound proteins (GRB7, GRB10, GRB14)
Plate: GDExt11035 Well: A12
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG135632.1
ORF Translation: ATO96984.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis hypothetical protein LOC549608, mRNA (cDNA clone MGC:146874 IMAGE:7861192), complete cds
Template Accession: BC123023
GI: 116063495
Clone ID: IMAGE:7861192
Tissue: oviduct
Stage:
Clone Library: NIH_XGC_tropOvi1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCACAGAATCGTTCAATGGAG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGACTCCCAGTCTTCCTCA


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556