Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19775861

Xenopus ORFeome
What is the ORFeome?

ORF Name:wasl ORF1 Species: tropicalis
Gene Symbol: wasl Entrez Gene ID: 407864
Gene Synonyms: n-wasp, nwasp
Gene Name: Wiskott-Aldrich syndrome like
Description: actin regulatory protein
Plate: GDExt11009 Well: E07
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG133442.1
ORF Translation: ATO94794.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis Wiskott-Aldrich syndrome-like, mRNA (cDNA clone MGC:75618 IMAGE:5379332), complete cds
Template Accession: BC067309
GI: 45501086
Clone ID: IMAGE:5379332
Tissue: whole organism
Stage: NF stage 20 to NF stage 27
Clone Library: NICHD_XGC_Emb7
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGTAACAATATCGGCCCTAA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAATCCTCCCATTCATCATCC


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.1


Major funding for Xenbase is provided by grant P41 HD064556