Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19775876

Xenopus ORFeome
What is the ORFeome?

ORF Name:wbp1l ORF1 Species: tropicalis
Gene Symbol: wbp1l Entrez Gene ID: 100037888
Gene Synonyms:
Gene Name: WW domain binding protein 1 like
Description:
Plate: GDExt11040 Well: C10
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG135936.1
ORF Translation: ATO97288.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis hypothetical protein LOC100037888, mRNA (cDNA clone MGC:121216 IMAGE:7595381), complete cds
Template Accession: BC135199
GI: 134025970
Clone ID: IMAGE:7595381
Tissue: whole organism
Stage: NF stage 35 and 36 to NF stage 41
Clone Library: NIH_XGC_tropTad5
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCTTTTCTCCTAGGGCTG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCCACGGGAGCTGCTGC


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.3


Major funding for Xenbase is provided by grant P41 HD064556