Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19775931

Xenopus ORFeome
What is the ORFeome?

ORF Name:wdr55 ORF1 Species: tropicalis
Gene Symbol: wdr55-like Entrez Gene ID: 780073
Gene Synonyms:
Gene Name: WD repeat domain 55 like
Description:
Plate: GDExt11027 Well: H09
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG135025.1
ORF Translation: ATO96377.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis hypothetical protein MGC146726, mRNA (cDNA clone MGC:146726 IMAGE:7676688), complete cds
Template Accession: BC123009
GI: 114108022
Clone ID: IMAGE:7676688
Tissue: testis
Stage:
Clone Library: NIH_XGC_tropTe3
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGGCTCAAGGGAAA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAGGTGAGGTTGGCCATC


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.1


Major funding for Xenbase is provided by grant P41 HD064556