Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19776141

Xenopus ORFeome
What is the ORFeome?

ORF Name:ywhag ORF1 Species: tropicalis
Gene Symbol: ywhag Entrez Gene ID: 779762
Gene Synonyms: 14-3-3 gamma, 14-3-3g, 14-3-3gamma, ywhag-a, ywhag-b
Gene Name: tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein gamma
Description: signal transduction
Plate: GDExt11031 Well: G09
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG135258.1
ORF Translation: ATO96610.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide, mRNA (cDNA clone MGC:145918 IMAGE:7660076), complete cds
Template Accession: BC121366
GI: 111305830
Clone ID: IMAGE:7660076
Tissue: brain
Stage: frog
Clone Library: NIH_XGC_tropBrn3
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGGACCGCGAGCAG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAATTGTTGCCTTCCCCACC


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.3


Major funding for Xenbase is provided by grant P41 HD064556