Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19776146

Xenopus ORFeome
What is the ORFeome?

ORF Name:ywhah ORF1 Species: tropicalis
Gene Symbol: ywhah Entrez Gene ID: 549622
Gene Synonyms: 14-3-3 eta, 14-3-3e
Gene Name: tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta
Description: signal transduction
Plate: GDExt11041 Well: G11
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG136072.1
ORF Translation: ATO97424.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide, mRNA (cDNA clone MGC:121469 IMAGE:7612341), complete cds
Template Accession: BC135498
GI: 134023824
Clone ID: IMAGE:7612341
Tissue: whole organism
Stage: NF stage 35 and 36 to NF stage 41
Clone Library: NIH_XGC_tropTad5
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGATCGGGAGCA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTGTTCCCTTCTCCAGT


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.1


Major funding for Xenbase is provided by grant P41 HD064556