Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19776236

Xenopus ORFeome
What is the ORFeome?

ORF Name:zfp36 ORF1 Species: tropicalis
Gene Symbol: zfp36 Entrez Gene ID: 100127733
Gene Synonyms: c3h-1, g0s24, gos24, nup475, rnf162a, tis11, tristetraproline, ttp
Gene Name: ZFP36 ring finger protein
Description: zinc finger, CCCH type
Plate: GDExt11048 Well: B07
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG136647.1
ORF Translation: ATO97999.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis zinc finger protein 36, C3H type, homolog, mRNA (cDNA clone MGC:181194 IMAGE:8911341), complete cds
Template Accession: BC154918
GI: 159155748
Clone ID: IMAGE:8911341
Tissue: tail
Stage: NF stage 55 to NF stage 66
Clone Library: NICHD_XGC_tropTail_m
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCTCTATCCTGGATATTC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAATCTGACACCGACAACCT


Publications
First:
Most recent:
View All Papers