Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19777199

Xenopus ORFeome
What is the ORFeome?

ORF Name:gsc ORF1 Species: tropicalis
Gene Symbol: gsc Entrez Gene ID: 549458
Gene Synonyms: goosecoid, gsc-a, gsc-b, xgsc
Gene Name: goosecoid homeobox
Description: homeodomain transcription factor
Plate: GDExt11034 Well: D09
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG135536.1
ORF Translation: ATO96888.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis hypothetical protein LOC100135186, mRNA (cDNA clone MGC:146901 IMAGE:7717456), complete cds
Template Accession: BC121520
GI: 113197729
Clone ID: IMAGE:7717456
Tissue: intestine
Stage: frog
Clone Library: NIH_XGC_tropInt1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCTTCTGGCATGTTCAGCATT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAACTGTCAGAGTCCAGGTCACTT


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556