Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions
XB-LINE-1856

Line Name: Xtr.runx1em3NXR


Summary
Synonym:
Species: Xenopus tropicalis
Background Strain: Xtr.Nigerian1NXR
Paternal Line:
Maternal Line:
Description: CRISPR knockout of runx1(runt related transcription factor 1). Germ line transmission confirmed. Animals carry a 1bp insertion in runx1 [plus1: CCCTCCACCACTCTGAGTTCCGGGGAAGATGAGCGAACCCATCCCG]
Phenotype Description:
Color Morph: pigmented
Breeding Type: OUTBRED
Lab of Origin: NXR
Line Type: Mutant
Mutated Gene(s): runx1
MTA Required: No
Public: Yes
Catalogue Number: tbd

Stock Center RRID Generation Availability Mutant Details
NXR (US) tbd
EXRC (Europe)
NBRP (Japan)
XLRRI (US)

Back to Search Lines