Search Criteria |
Gene/Clone | Species | Stage | Anatomy Item | Experimenter |
---|---|---|---|---|
hsd17b10 | xenopus | blastomere [+] |
Too many results?Too few results?
Experiment details for hsd17b10
A non-enzymatic function of 17beta-hydroxysteroid dehydrogenase type 10 is required for mitochondrial integrity and cell sur...A non-enzymatic function of 17beta-hydroxysteroid dehydrogenase type 10 is required for mitochondrial integrity and cell survival.
|
Display additional annotations [+] |
||||||||||
Supplementary Figure 8 Expression pattern of HSD10 mRNA. (A) The spatial expression pattern of HSD10 mRNA is shown by wholemount in situ hybridization. Signal is observed in early stages (NF5 to 10.5) and in tadpole stages (NF41) in ventral parts of the somites, neural tube, pronephros and eye. DIG-labelled antisense RNA as a probe for in situ hybridization was synthesized using Digoxygenin RNA labelling Kit (Roche) with pCS2+_myc/xHSD10 digested with SalI as a template. (B) The temporal expression pattern of HSD10 mRNA is shown by reverse transcription PCR analysis. cDNA for reverse transcription PCR was synthesized from total RNA of Xenopus embryos of different NF stages using Revert Aid M-MuLV RT (Fermentas). For the detection of HSD10, the following primer combinations and a standardized PCR protocol with 30 cycles and a T m of 56,3°C were used: HSD10 5’caccctgtcactgctctgaa3’ and 5’catcttggatttgcccaagt3’ and ODC 5’gtcaatgatggagtgtatggatc3’ and 5’tccattccgctctcctgagcac3’. Maternal mRNA for HSD10 exists until stage NF10.5, zygotic expression starts at stage NF19.5. | |||||||||||
|
|
||||||||||
hsd17b10 (hydroxysteroid (17-beta) dehydrogenase 10 ) gene expression in Xenopus laevis embryo, assayed via in situ hybridization, NF stage 5, ?????view. |