|
XB-LIB-157
Library Name: NICHD_XGC_Emb9 |
Species: Xenopus laevis |
Number Of Clones: 4248 |
Description: cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection 1.4kb resulted in an average insert size of 2.1kb. This is a non-normalized primary library (normalized library is NICHD_XGC_Emb10) and was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.
| Normalized: No | Subtraction: No |
| Anatomy: whole organism | Stage: NF stage 17 to NF stage 19 |
| Vector Details | Vector Map | Name: pExpress-1 Type: plasmid 5' Restriction Site: EcoRV 3' Restriction Site: NotI |  |