Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249314

Morpholino Name: creb1 MO1
Synonyms: CREB, CREB AMO
Target mRNA: creb1

Morpholino Type: uncategorized morpholino
Sequence: 5' CACTGCCTCCTCTCCGTCACATTGG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr5L:170695914..170695938 21/25 unknown
Publications
First: The role of maternal CREB in early embryogenesis of Xenopus laevis., Dev Biol 2003  
Most recent: Neural ectoderm-secreted FGF initiates the expression of Nkx2.5 in cardiac progenitors via a p38 MAPK/CREB pathway., Dev Biol 2009              
View All Papers