Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249387

Morpholino Name: dlx3 MO1
Synonyms: Dlx3 MO
Target mRNA: dlx3

Morpholino Type: uncategorized morpholino
Sequence: 5' CAGAGCCGGAGAAACGAACCAGACT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' AGTCTGGTTCGTTTCTCCGGCTCTG 3' ||||||||||||||||||||||||| 3' TCAGACCAAGCAAAGAGGCCGAGAC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr9_10L:4811181..4811205 25/25 Antisense target dlx3.L
Chr5S:64655223..64655247 21/25 unknown
Publications
First: Differential distribution of competence for panplacodal and neural crest induction to non-neural and neural ectoderm., Development 2012                      
Most recent: A gene regulatory network underlying the formation of pre-placodal ectoderm in Xenopus laevis., BMC Biol 2018                              
View All Papers