Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249677

Morpholino Name: hes4 MO1
Synonyms: Hairy2a MO, Hairy2aMO, Xhairy2a MO, hairy2a
Target mRNA: hes4

Morpholino Type: uncategorized morpholino
Sequence: 5' ATGGTATCTGCGGGCATGTTCAGTT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 21/25 25/25
genomic

MO
5' ATCTGAACATGCCTGCAGATAGTAT 3' | ||||||||||| ||||||| || 3' TTGACTTGTACGGGCGTCTATGGTA 5' 5' AACTGAACATGCCCGCAGATACCAT 3' ||||||||||||||||||||||||| 3' TTGACTTGTACGGGCGTCTATGGTA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7S:77144932..77144956 25/25 Antisense target hes4.S
Chr7L:90956860..90956884 21/25 Antisense target hes4.L
Chr3L:144107600..144107624 21/25 Sense off-target gipc1.L
Chr1S:197205138..197205162 21/25 unknown
tropicalis 10.0 Chr5:32699363..32699387 21/25 1 Antisense off-target ugp2
Chr10:42466872..42466896 21/25 2 Antisense off-target samhd1
Chr1:119314251..119314275 21/25 3 unknown
Publications
First: The Notch-target gene hairy2a impedes the involution of notochordal cells by promoting floor plate fates in Xenopus embryos., Development 2005                
Most recent: A gene regulatory network underlying the formation of pre-placodal ectoderm in Xenopus laevis., BMC Biol 2018                              
View All Papers