Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249678

Morpholino Name: hes4 MO2
Synonyms: Hairy2b MO, Hairy2bMO, Xhairy2b
Target mRNA: hes4

Morpholino Type: uncategorized morpholino
Sequence: 5' GGCATGTTCAGATGTTGTATCCGGA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' TCCGGATACAACATCTGAACATGCC 3' ||||||||||||||||||||||||| 3' AGGCCTATGTTGTAGACTTGTACGG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7L:90956848..90956872 25/25 Antisense target hes4.L
Chr3L:144107588..144107612 24/25 Sense off-target gipc1.L
Chr3L:132967459..132967483 22/25 Antisense off-target cnnm4.L
Chr1L:176996985..176997009 21/25 Antisense off-target atxn2.L
Chr7L:3088669..3088693 21/25 Antisense off-target fhip2a.L
Chr1L:63629890..63629914 21/25 Antisense off-target LOC108699497
Chr1S:197205150..197205174 24/25 unknown
Publications
First: The Notch-effector HRT1 gene plays a role in glomerular development and patterning of the Xenopus pronephros anlagen., Development 2006                    
Most recent: A gene regulatory network underlying the formation of pre-placodal ectoderm in Xenopus laevis., BMC Biol 2018                              
View All Papers