Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249792

Morpholino Name: jun MO1
Synonyms: MO-jun55
Target mRNA: jun

Morpholino Type: uncategorized morpholino
Sequence: 5' GTAGTTTCCATCTTTGCGTTCATAC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 22/25
genomic

MO
5' GTATGAACGCAAAGATGGAAACTAC 3' ||||||||||||||||||||||||| 3' CATACTTGCGTTTCTACCTTTGATG 5' 5' CTATGAGCGCAAAGATGGAACCTAC 3' ||||| ||||||||||||| |||| 3' CATACTTGCGTTTCTACCTTTGATG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr4L:81475750..81475774 25/25 Antisense target jun.L
Chr4S:67257568..67257592 22/25 Antisense target jun.S
Publications
First: Transcriptional regulation of Zic3 by heterodimeric AP-1(c-Jun/c-Fos) during Xenopus development., Exp Mol Med 2004  
Most recent: PAPC mediates self/non-self-distinction during Snail1-dependent tissue separation., J Cell Biol 2015                      
View All Papers