Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249793

Morpholino Name: jun MO2
Synonyms: MO-jun54
Target mRNA: jun

Morpholino Type: uncategorized morpholino
Sequence: 5' CTGGAGCTTATGTCAGTGTGA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 21/21
genomic

MO
5' TCACACTGACATAAGCTCCAG 3' ||||||||||||||||||||| 3' AGTGTGACTGTATTCGAGGTC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr4S:67257522..67257542 21/21 Antisense target jun.S
Chr4L:2673087..2673107 19/21 Antisense off-target nav2.L
Chr3L:104508984..104509004 18/21 Sense off-target sltm.L
Chr9_10L:45991736..45991756 18/21 Antisense off-target epn3.L
Chr1L:212241308..212241328 17/21 Antisense off-target paip1.L
Chr1S:104940040..104940060 18/21 Sense off-target eps15l1.S
Chr8L:97338109..97338129 17/21 Sense off-target LOC108698980
Chr1S:152695122..152695142 19/21 unknown
Chr3S:96216626..96216646 18/21 unknown
tropicalis 10.0 Chr2:172153887..172153907 19/21 1 unknown
Chr2:105800911..105800931 18/21 2 unknown
Chr9:23460264..23460284 18/21 3 unknown
Chr6:58087281..58087301 17/21 4 unknown
Publications
First: Transcriptional regulation of Zic3 by heterodimeric AP-1(c-Jun/c-Fos) during Xenopus development., Exp Mol Med 2004  
Most recent: PAPC mediates self/non-self-distinction during Snail1-dependent tissue separation., J Cell Biol 2015                      
View All Papers