Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250116

Morpholino Name: pou5f3.1 MO2
Synonyms: Xlpou91
Target mRNA: pou5f3.1

Morpholino Type: uncategorized morpholino
Sequence: 5' GTAGGTCTGTTGGTTATACATGATC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 25/25
genomic

MO
5' GACCATGTATAACCAACAGGCCTAC 3' || |||||||||||||||| ||||| 3' CTAGTACATATTGGTTGTCTGGATG 5' 5' GATCATGTATAACCAACAGACCTAC 3' ||||||||||||||||||||||||| 3' CTAGTACATATTGGTTGTCTGGATG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr8L:2308469..2308493 25/25 Antisense target pou5f3.1.L
Chr7L:55146028..55146052 21/25 Antisense off-target polr3a.L
Chr6L:35722666..35722690 21/25 unknown
tropicalis 10.0 Chr8:3301464..3301488 23/25 1 Antisense target pou5f3.1
Publications
First: Conserved roles for Oct4 homologues in maintaining multipotency during early vertebrate development., Development 2006                  
Most recent: Spalt-like 4 promotes posterior neural fates via repression of pou5f3 family members in Xenopus., Development 2014                                                                  
View All Papers