Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250183

Morpholino Name: rab3d MO1
Synonyms: Rab3d
Target mRNA: rab3d

Morpholino Type: uncategorized morpholino
Sequence: 5' GGTGCAGTCTCTTGCTCGGGTGTCT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/25 24/25 23/25
genomic

MO
5' AGGCACCCAAGCCAGAGACTGCACC 3' || ||||| ||| |||||||||||| 3' TCTGTGGGCTCGTTCTCTGACGTGG 5' 5' AGACACCCGAGCTAGAGACTGCACC 3' |||||||||||| |||||||||||| 3' TCTGTGGGCTCGTTCTCTGACGTGG 5' 5' AGGAACCCGAGCAAGAGACTGCACC 3' || ||||||||||||||||||||| 3' TCTGTGGGCTCGTTCTCTGACGTGG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3L:149549398..149549422 24/25 Antisense target rab3d.L
Chr3S:125044539..125044563 23/25 Antisense target rab3d.S
Chr5L:95442001..95442025 21/25 unknown
tropicalis 10.0 Chr3:140086840..140086864 22/25 1 Antisense target rab3d
Chr6:12354188..12354212 21/25 2 Antisense off-target setd2
Publications
First: Rab3d is required for Xenopus anterior neurulation by regulating Noggin secretion., Dev Dyn 2011                
Most recent:
View All Papers