Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250365

Morpholino Name: sox10 MO1
Synonyms: Sox10
Target mRNA: sox10

Morpholino Type: uncategorized morpholino
Sequence: 5' AGCTTTGGTCATCACTCATGGTGCC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' GGCACCATGAGTGATGACCAAAGCT 3' ||||||||||||||||||||||||| 3' CCGTGGTACTCACTACTGGTTTCGA 5' 5' GGCACCATGAGTGATGACCAAAGCT 3' ||||||||||||||||||||||||| 3' CCGTGGTACTCACTACTGGTTTCGA 5' 5' GGCACCATGAGTGATGACCAAAGCT 3' ||||||||||||||||||||||||| 3' CCGTGGTACTCACTACTGGTTTCGA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr4L:120284532..120284556 25/25 Antisense target sox10.L
Chr4S:101374658..101374682 25/25 Antisense target sox10.S
tropicalis 10.0 Chr4:122168817..122168841 25/25 1 Antisense target sox10
Publications
First: Sox10 is required for the early development of the prospective neural crest in Xenopus embryos., Dev Biol 2003  
Most recent: A transition from SoxB1 to SoxE transcription factors is essential for progression from pluripotent blastula cells to neural crest cells., Dev Biol 2018                  
View All Papers