Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17251717

Morpholino Name: ventx1.1 MO2
Synonyms:
Target mRNA: ventx1.1

Morpholino Type: uncategorized morpholino
Sequence: 5' ATAGAGAATCCCTGTTGAACCATGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' GCATGGTTCAACAGGGATTCTCTAT 3' ||||||||||||||||||||||||| 3' CGTACCAAGTTGTCCCTAAGAGATA 5' 5' GCATGGTTCAACAGGGATTCTCTAT 3' ||||||||||||||||||||||||| 3' CGTACCAAGTTGTCCCTAAGAGATA 5' 5' GCATGGTTCAACAGGGATTCTCTAT 3' ||||||||||||||||||||||||| 3' CGTACCAAGTTGTCCCTAAGAGATA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7L:21791416..21791440 25/25 Antisense target ventx1.1.L
Chr7S:16918052..16918076 25/25 Antisense target ventx1.1.S
Chr7L:21748895..21748919 25/25 Antisense off-target ventx1.2.L
Chr7S:16878226..16878250 25/25 Antisense off-target ventx1.2.S
tropicalis 10.0 Chr7:26893167..26893191 25/25 1 Antisense target ventx1.1
Chr7:26856612..26856636 25/25 2 Antisense off-target ventx1.2
Publications
First: A p38 MAPK-CREB pathway functions to pattern mesoderm in Xenopus., Dev Biol 2008          
Most recent:
View All Papers