Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17251719

Morpholino Name: ventx2.1 MO3
Synonyms:
Target mRNA: ventx2.1

Morpholino Type: uncategorized morpholino
Sequence: 5' TTTAGTCATCTTGTCTGTATTAGTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25
genomic

MO
5' GACTAATACAGACAAGATGACTAAA 3' ||||||||||||||||||||||||| 3' CTGATTATGTCTGTTCTACTGATTT 5' 5' GACTAATACAGACAAGATGACCAAA 3' ||||||||||||||||||||| ||| 3' CTGATTATGTCTGTTCTACTGATTT 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7L:21807362..21807386 25/25 Antisense target ventx2.1.L
Chr7S:16928488..16928512 24/25 Antisense target ventx2.1.S
Chr1S:29817284..29817308 21/25 Antisense off-target cracd.S
Chr2S:131738298..131738322 21/25 Antisense off-target stac3.S
Chr7L:21777308..21777332 25/25 Antisense off-target ventx2.2.L
Chr7S:16903341..16903365 24/25 Antisense off-target ventx2.2.S
Chr9_10S:15043666..15043690 21/25 Antisense off-target LOC108702638
Chr2S:137964988..137965012 22/25 unknown
Chr3L:112599834..112599858 21/25 unknown
Chr6L:92206290..92206314 21/25 unknown
Chr9_10L:76361959..76361983 21/25 unknown
tropicalis 10.0 Chr1:77417787..77417811 21/25 1 Antisense off-target grid2
Chr3:38180133..38180157 21/25 2 Sense off-target arhgap26
Publications
First: A p38 MAPK-CREB pathway functions to pattern mesoderm in Xenopus., Dev Biol 2008          
Most recent:
View All Papers