Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659380

gRNA Name: gfi1 gRNA1
Synonyms: trop gfi1 T7
Genomic Target: gfi1

Sequence: 5' CCCTCACTGGATGAGTCCCCGCC 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 23/23 21/23 22/23
genomic

gRNA
5' GGCGGGGACTCATCCAGTGAGGG 3' ||||||||||||||||||||||| 3' CCGCCCCTGAGTAGGTCACTCCC 5' 5' GGCGGAGACTCATCCAGAGAGGG 3' ||||| ||||||||||| ||||| 3' CCGCCCCTGAGTAGGTCACTCCC 5' 5' GGCGGGGACTCATCCAGAGAGGG 3' ||||||||||||||||| ||||| 3' CCGCCCCTGAGTAGGTCACTCCC 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr4S:84039946..84039968 22/23 Sense target gfi1.S
Chr4L:100478332..100478354 21/23 Sense target gfi1.L
Chr7S:106088513..106088535 19/23 Sense off-target LOC108705550
tropicalis 10.0 Chr4:104456620..104456642 23/23 1 Sense target gfi1
Chr1:72200175..72200197 23/23 2 Sense off-target aimp1
Chr1:75243447..75243469 23/23 3 Antisense off-target stpg2
Chr3:14009276..14009298 23/23 4 Antisense off-target adam19
Chr8:98644879..98644901 23/23 5 Antisense off-target ppp1r13b
Chr4:46910691..46910713 23/23 6 unknown
Chr5:106523710..106523732 23/23 7 unknown
Publications
First:
Most recent:
View All Papers