|
XB-gRNA-25900335
Genomic Target | tropicalis | laevis.L | laevis.S | ||||
Identities | 20/21 | ||||||
genomic gRNA |
5' CCTGGGGGTTCCTGCGAGAC 3' |||||||||||||||||||| 3' GGACCCCCAAGGACGCTCTG 5' | ||||||
Genomic Alignments ![]() |
Position | Identity | Strand | Target | Genomic Target | ||
laevis 10.1 | Chr6L:84270912..84270931 | 16/20 | Sense | off-target | cdh12.L | ||
Chr5S:34078857..34078876 | 18/20 | Sense | off-target | LOC108717401 | tropicalis 10.0 | Chr5:42572456..42572475 | 20/20 | 1 Sense | target | map4k3 |
Chr10:2639669..2639688 | 16/20 | 2 Antisense | off-target | ppp4r1l | |||
Publications | |||||||
First: |
Identification and validation of candidate risk genes in endocytic vesicular trafficking associated with esophageal atresia and tracheoesophageal fistulas., HGG Adv 2022 ![]() |
||||||
Most recent: | |||||||
View All Papers |