|
XB-CLONE-1629366
| Clone Name: IMAGE:8072432 | Gene: eef1g.L | Species: Xenopus laevis | |
Sequence:
5' EST: DT070265
[+]
Library:
| Name: NICHD_XGC_FaB | External Dbs: Unigene laevis cDNA library, Xenopus IMAGE cDNA Library |
Description: cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection 1.2kb resulted in an average insert size of 1.8kb. This is a primary library (normalized library is NICHD_XGC_FaBN) and was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.
| Anatomy: fat body | Stage: |
| Normalized: No | Subtraction: No |
| Vector Details | Vector Map | Name: pExpress-1 Type: plasmid 5' Restriction Site: EcoRV 3' Restriction Site: NotI |
Usage:
Suppliers:
Search for clone at: Open Biosystems
