XB-CLONE-3385526
|
Clone Name: IMAGE:7805758
|
Gene:
rps3
|
Species: Xenopus tropicalis
|
|
|
|
Sequence:
5' EST: DR842104
[+]
ctgacggcatcttcaaggctgaactcaatgagttccttactcgggagctggctgaagatggctactccggtgtagaggtcagagtcaccccaacccggac
tgaaatcatcattctcgctaccagaacccaaaatgttctgggtgagaagggcaggcgcatccgtgagctgactgcagttgttcagaagaggtttggattc
cctgaagggagtgttgagctctatgctgagaaagttgccacaaggggtctgtgtgccattgcccaagccgaatctctccgttacaaactcctgggaggtc
tggctgtgaggagagcttgctatggtgtcctccgtttcatcatggagagtggagccaagggttgtgaggttgtcgtgtccggaaaactaagaggccagag
agccaagtccatgaagttcgtagacggcctgatgatccacagtggagatccagttaattactacgtggatactgctgtacgccatgtgctcctcaggcag
ggtgtccttggaatcaaggtaaagattatgcttccctgggatccaagtggaaagatcggacccaagaagcccctgcctgaccacgtcagcattgttgagc
ccaaggaagagattctgcctacaacccccatctctgagcagaagggagccaagccagatcagccacaaccacccgccatgccacagcctgtgcccacagc
ataatgggctgaagtcctggattcaaagattttggatacagtatcagaacatctaanataaaaaaattaaaatccaaaaaaaaaaaaaaaaaa
3' EST: DR842103
[+]ggattttaatttttttattttagatgttctgatactgtatccaaaatctttgaatccaggacttcagcccattatgctgtgggcacaggctgtggcatgg
cgggtggttgtggctgatctggcttggctcccttctgctcagagatgggggttgtaggcagaatctcttccttgggctcaacaatgctgacgtggtcagg
caggggcttcttgggtccgatctttccacttggatcccagggaagcataatctttaccttgattccaaggacaccctgcctgaggagcacatggcgtaca
gcagtatccacgtagtaattaactggatctccactgtggatcatcaggccgtctacgaacttcatggacttggctctctggcctcttagttttccggaca
cgacaacctcacaacccttggctccactctccatgatgaaacggaggacaccatagcaagctctcctcacagccagacctcccaggagtttgtaacggag
agattcggcttgggcaatggcacacagaccccttgtggcaactttctcagcatagagctcaacactcccttcagggaatccaaacctcttctgaacaact
gcagtcagctcacggatgcgcctgcccttctcacccagaacattttgggttctggtagcgagaatgatgatttcagtccgggttggggtgactctgacct
ctacaccggagtagccatcttcagccagctcccgagtaaggaactcattgagttcagccttgaagatgccgtcag
Library:
Description: The library was prepared from 5 ug of poly A+ RNA by oligo-dT priming (5'- ACTAGTGCGGCCGCCTAGGCCTCGAGTTTTTTTTTTTTTTTTTTV-3') and Stratascript reverse transcriptase. After ligation of EcoRI adapters (5'-AATTCGGCACGAGG-3') followed by kinasing adapters and by XhoI digestion, the cDNA was size selected by chromatography on Sepharose CL-2B columns and fractions containing cDNAs larger than 1000 bp were ligated into EcoRI/XhoI-digested pCS107. Average insert size 1905 bp. Reference for library construction: Current Genomics 4, 635-644. Library constructed by Michelle Tabb and Bruce Blumberg (Dept of Developmental and Cell Biology, University of California, Irvine).| Vector Details | Vector Map |
Name: pCS107
Type: plasmid
5' Restriction Site: EcoRI
3' Restriction Site: XhoI |  |
Usage:
Suppliers: