Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249121

Morpholino Name: adamts1 MO1
Synonyms: XADAMTS1b
Target mRNA: adamts1

Morpholino Type: splice blocking morpholino (E1-I1)
Sequence: 5' GGTGTAACATACCTGTGGGTGGCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 21/25 21/25 25/25
genomic

MO
5' ATGCCACCTACAGGTATGTTACTTT 3' |||||||| ||||||||||||| 3' TACGGTGGGTGTCCATACAATGTGG 5' 5' ATGCCACCCACAGGTATGTCACTGT 3' ||||||||||||||||||| || 3' TACGGTGGGTGTCCATACAATGTGG 5' 5' ATGCCACCCACAGGTATGTTACACC 3' ||||||||||||||||||||||||| 3' TACGGTGGGTGTCCATACAATGTGG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2S:17149951..17149975 25/25 Antisense target adamts1.S
Chr2L:17508703..17508727 21/25 Antisense target adamts1.L
Chr6S:117485774..117485798 21/25 Antisense off-target ncald.S
tropicalis 10.0 Chr2:18148691..18148715 21/25 Antisense target adamts1
Chr2:98273696..98273720 22/25 Sense off-target tyw1
Publications
First: Xenopus ADAMTS1 negatively modulates FGF signaling independent of its metalloprotease activity., Dev Biol 2006      
Most recent:
View All Papers