Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249122

Morpholino Name: adamts1 MO2
Synonyms: XADAMTS1a
Target mRNA: adamts1

Morpholino Type: splice blocking morpholino (E1-I1)
Sequence: 5' TAACAGTGACATACCTGTGGGTGGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GCCACCCACAGGTATGTCACTGTTA 3' ||||||||||||||||||||||||| 3' CGGTGGGTGTCCATACAGTGACAAT 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2L:17508705..17508729 25/25 Antisense target adamts1.L
Chr1L:186959382..186959406 21/25 Sense off-target trim36.L
Chr4S:85988735..85988759 21/25 Antisense off-target hs2st1.S
Chr6S:44101071..44101095 21/25 Sense off-target znrf2.S
tropicalis 10.0 Chr2:3236843..3236867 21/25 Sense off-target atp6v1a
Chr2:3236876..3236900 21/25 Sense off-target atp6v1a
Publications
First: Xenopus ADAMTS1 negatively modulates FGF signaling independent of its metalloprotease activity., Dev Biol 2006      
Most recent:
View All Papers