Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249127

Morpholino Name: aftph MO1
Synonyms: TGas061h10, XtAftiphilin
Target mRNA: aftph

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' ATTCGGATAATTTCAGGCTCCATAG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25 23/25
genomic

MO
5' CTATGGAGCCTGAAATTATCCGAAT 3' ||||||||||||||||||||||||| 3' GATACCTCGGACTTTAATAGGCTTA 5' 5' CTATGGAGCCTGAAATCATCCGAAT 3' |||||||||||||||| |||||||| 3' GATACCTCGGACTTTAATAGGCTTA 5' 5' TGATGGAGCCTGAAATTATCCGAAT 3' ||||||||||||||||||||||| 3' GATACCTCGGACTTTAATAGGCTTA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr5L:30357211..30357235 24/25 Antisense target aftph.L
chr5S:1704646..1704670 23/25 Antisense target aftph.S
chr1S:79159160..79159184 21/25 unknown
tropicalis 10.0 Chr5:32359726..32359750 25/25 Antisense target aftph
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers