Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249131

Morpholino Name: ahnak MO2
Synonyms: TNeu103f06, Xtnovel34.2
Target mRNA: ahnak

Morpholino Type: translation blocking morpholino (5' UTR)
Sequence: 5' GGTTAGTCAGTTACCAGTTCTGTAA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25 23/25
genomic

MO
5' TTACAGAACTGGTAACTGACTAACC 3' ||||||||||||||||||||||||| 3' AATGTCTTGACCATTGACTGATTGG 5' 5' TTACAGAACTGGTAACTAACTAACC 3' ||||||||||||||||| ||||||| 3' AATGTCTTGACCATTGACTGATTGG 5' 5' TTACTGAACTGGTAACTAACTAACC 3' |||| |||||||||||| ||||||| 3' AATGTCTTGACCATTGACTGATTGG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr4L:26282439..26282463 24/25 Antisense target ahnak.L
chr4S:1641597..1641621 23/25 Antisense target ahnak.S
tropicalis 10.0 Chr4:36702558..36702582 25/25 Antisense target ahnak
Chr1:123495233..123495257 22/25 Sense off-target LOC116406524
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers