Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249146

Morpholino Name: ap1m1 MO1
Synonyms: AP-1 mu1A, TNeu104l10, XtM1a
Target mRNA: ap1m1

Morpholino Type: translation blocking morpholino (5' UTR)
Sequence: 5' GCCGAAGATAGTCCTGCAAAGGCAA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 22/25
genomic

MO
5' TTGCCTTTGCAGGACTATCTTCGGC 3' ||||||||||||||||||||||||| 3' AACGGAAACGTCCTGATAGAAGCCG 5' 5' TTGCCTTCGAAGGGCTATCTTCGGC 3' ||||||| | ||| ||||||||||| 3' AACGGAAACGTCCTGATAGAAGCCG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr1S:84013596..84013620 22/25 Antisense target ap1m1.S
chr6L:137576654..137576678 22/25 unknown
tropicalis 10.0 Chr1:98839653..98839677 25/25 Antisense target ap1m1
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent: CVAK104 is a novel regulator of clathrin-mediated SNARE sorting., Traffic 2007              
View All Papers