Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249173

Morpholino Name: ints13 MO1
Synonyms: Mat89Bb, asun MO1
Target mRNA: ints13

Morpholino Type: uncategorized morpholino
Sequence: 5' TCCGAGAAAGTCTTCATCTTGTCTG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 24/25
genomic

MO
5' TAGACAAGATGAAGACTTTCTCGGA 3' |||||||||||||||||||||||| 3' GTCTGTTCTACTTCTGAAAGAGCCT 5' 5' TAGACAAGATGAAGACTTTCTCGGA 3' |||||||||||||||||||||||| 3' GTCTGTTCTACTTCTGAAAGAGCCT 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr3S:1349481..1349505 24/25 Antisense target ints13.S
chr3L:1895256..1895280 22/25 Antisense off-target LOC108710708 [provisional:ints13]
chr1S:58501654..58501678 21/25 Sense off-target LOC108706716
chr5L:110154146..110154170 21/25 Antisense off-target bche.L
chr7L:67991988..67992012 21/25 Antisense off-target LOC108696393
chr4L:44984150..44984174 22/25 unknown
tropicalis 10.0 Chr3:2581804..2581828 24/25 Antisense target ints13
Publications
First: Drosophila genome-scale screen for PAN GU kinase substrates identifies Mat89Bb as a cell cycle regulator., Dev Cell 2005    
Most recent:
View All Papers