Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249182

Morpholino Name: bard1 MO2
Synonyms: xBARD1 AS#1
Target mRNA: bard1

Morpholino Type: uncategorized morpholino
Sequence: 5' CCTTAGCAGCATAATGAGGGGAGCC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 21/25 25/25
genomic

MO
5' GTTTCCCCTCGGTATGCTGCTAAGG 3' | ||||||| ||||||||||||| 3' CCGAGGGGAGTAATACGACGATTCC 5' 5' GGCTCCCCTCATTATGCTGCTAAGG 3' ||||||||||||||||||||||||| 3' CCGAGGGGAGTAATACGACGATTCC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr9_10L:74010675..74010699 25/25 Antisense target bard1.L
chr2S:28540595..28540619 21/25 Antisense off-target wars2.S
chr2L:168477072..168477096 21/25 unknown
tropicalis 10.0 Chr9:58357093..58357117 21/25 Antisense target bard1
Chr1:75289169..75289193 21/25 Sense off-target stpg2
Chr3:132832045..132832069 21/25 Sense off-target akap8
Chr5:147515589..147515613 21/25 Sense off-target runx2
Publications
First: Functional communication between endogenous BRCA1 and its partner, BARD1, during Xenopus laevis development., Proc Natl Acad Sci U S A 2001                  
Most recent:
View All Papers