Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249183

Morpholino Name: barhl2 MO1
Synonyms: Xbarhl2ASII
Target mRNA: barhl2

Morpholino Type: uncategorized morpholino
Sequence: 5' CTATCCCAAAGCTGGATCCTTCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' ATGGAAGGATCCAGCTTTGGGATAG 3' ||||||||||||||||||||||||| 3' TACCTTCCTAGGTCGAAACCCTATC 5' 5' ATGGAAGGATCCAGCTTTGGGATAG 3' ||||||||||||||||||||||||| 3' TACCTTCCTAGGTCGAAACCCTATC 5' 5' ATGGAAGGATCCAGCTTTGGGATAG 3' ||||||||||||||||||||||||| 3' TACCTTCCTAGGTCGAAACCCTATC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr4L:101225821..101225845 25/25 Antisense target barhl2.L
Chr4S:84617046..84617070 25/25 Antisense target barhl2.S
Chr6L:134925785..134925809 21/25 unknown
tropicalis 10.0 Chr4:105189332..105189356 25/25 Antisense target barhl2
Chr8:128613726..128613750 21/25 unknown
Publications
First: The pro-apoptotic activity of a vertebrate Bar-like homeobox gene plays a key role in patterning the Xenopus neural plate by limiting the number of chordin- and shh-expressing cells., Development 2005            
Most recent: Barhl2 maintains T cell factors as repressors and thereby switches off the Wnt/β-Catenin response driving Spemann organizer formation., Development 2019                                              
View All Papers