Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249184

Morpholino Name: barhl2 MO2
Synonyms: Xbarhl2ASI
Target mRNA: barhl2

Morpholino Type: uncategorized morpholino
Sequence: 5' GATCCTTCCATGCTGCTTCCAGTTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/25 25/25 23/25
genomic

MO
5' GACTGGGAAGCAGCATGGAAGGATC 3' || |||||||||||||||||||| 3' CTTGACCTTCGTCGTACCTTCCTAG 5' 5' GAACTGGAAGCAGCATGGAAGGATC 3' ||||||||||||||||||||||||| 3' CTTGACCTTCGTCGTACCTTCCTAG 5' 5' GAATGGGAAGCAGCATGGAAGGATC 3' ||| |||||||||||||||||||| 3' CTTGACCTTCGTCGTACCTTCCTAG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr4L:101225807..101225831 25/25 Antisense target barhl2.L
Chr4S:84617032..84617056 23/25 Antisense target barhl2.S
Chr1L:87811618..87811642 21/25 Sense off-target fras1.L
Chr3L:66688428..66688452 21/25 Sense off-target zfc3h1.L
Chr3S:88013207..88013231 21/25 Sense off-target LOC108713147
Chr5S:68935446..68935470 21/25 Antisense off-target mchr2.S
Chr2L:67308936..67308960 21/25 unknown
Chr3L:17591124..17591148 21/25 unknown
Chr5L:155192920..155192944 21/25 unknown
Chr8L:123731269..123731293 21/25 unknown
tropicalis 10.0 Chr4:105189318..105189342 22/25 Antisense target barhl2
Chr6:65764354..65764378 22/25 Sense off-target ccdc127
Chr1:207637780..207637804 21/25 Antisense off-target setbp1
Chr6:52937780..52937804 21/25 Antisense off-target acad11
Chr3:59912407..59912431 21/25 Sense off-target zfc3h1
Publications
First: The pro-apoptotic activity of a vertebrate Bar-like homeobox gene plays a key role in patterning the Xenopus neural plate by limiting the number of chordin- and shh-expressing cells., Development 2005            
Most recent: Barhl2 maintains T cell factors as repressors and thereby switches off the Wnt/β-Catenin response driving Spemann organizer formation., Development 2019                                              
View All Papers