Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249190

Morpholino Name: bdnf MO2
Synonyms: bdnf
Target mRNA: bdnf

Morpholino Type: uncategorized morpholino
Sequence: 5' ATGGTCATCACTCTTCTCACCTGA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/24 24/24 24/24
genomic

MO
5' TCAGGTGAGAAGAGTGATGACCAT 3' |||||||||||||||||||||||| 3' AGTCCACTCTTCTCACTACTGGTA 5' 5' TCAGGTGAGAAGAGTGATGACCAT 3' |||||||||||||||||||||||| 3' AGTCCACTCTTCTCACTACTGGTA 5' 5' TCAGGTGAGAAGAGTGATGACCAT 3' |||||||||||||||||||||||| 3' AGTCCACTCTTCTCACTACTGGTA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr4L:14889537..14889560 24/24 Antisense target bdnf.L
chr4S:8333352..8333375 24/24 Antisense target bdnf.S
chr4L:90868895..90868918 20/24 Sense off-target cacna1e.L
chr6L:6136426..6136449 20/24 Antisense off-target obscn.L
chr1L:31308463..31308486 20/24 unknown
tropicalis 10.0 Chr4:20980236..20980259 24/24 Antisense target bdnf
Chr2:174767202..174767225 20/24 Antisense off-target LOC116406442
Chr3:22233447..22233470 20/24 Antisense off-target tbc1d9b
Chr3:78045647..78045670 20/24 Sense off-target fam185a
Chr3:81447565..81447588 20/24 unknown
Publications
First: BDNF promotes target innervation of Xenopus mandibular trigeminal axons in vivo., BMC Dev Biol 2007                    
Most recent:
View All Papers