Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249195

Morpholino Name: bix1.1 MO1
Synonyms: Bix3MO, bix3 MO
Target mRNA: bix1.1

Morpholino Type: uncategorized morpholino
Sequence: 5' TCCTGGGTCTGTACTTCCAAATCTG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' CAGATTTGGAAGTACAGACCCAGGA 3' ||||||||||||||||||||||||| 3' GTCTAAACCTTCATGTCTGGGTCCT 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr5L:17310621..17310645 25/25 Antisense target bix1.1.L
chr5L:17295314..17295338 25/25 Antisense off-target bix1.3.L
chr5L:17302194..17302218 25/25 Antisense off-target bix1.2.L
chr5S:132350770..132350794 21/25 Antisense off-target LOC108718302
chr7L:81235637..81235661 22/25 unknown
chr8L:105533706..105533730 21/25 unknown
tropicalis 10.0 Chr7:120349068..120349092 21/25 unknown
Publications
First: Regulation of apoptosis in theXenopus embryo by Bix3., Development 2003                    
Most recent:
View All Papers