Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249199

Morpholino Name: bmp4 MO1
Synonyms: BMP4 MO, Bmp4, TNeu045c17, XtBMP4, bmp4-2ome
Target mRNA: bmp4

Morpholino Type: uncategorized morpholino
Sequence: 5' CAGCATTCGGTTACCAGGAATCATG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' CATGATTCCTGGTAACCGAATGCTG 3' ||||||||||||||||||||||||| 3' GTACTAAGGACCATTGGCTTACGAC 5' 5' CATGATTCCTGGTAACCGAATGCTG 3' ||||||||||||||||||||||||| 3' GTACTAAGGACCATTGGCTTACGAC 5' 5' CATGATTCCTGGTAACCGAATGCTG 3' ||||||||||||||||||||||||| 3' GTACTAAGGACCATTGGCTTACGAC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr8L:71226880..71226904 25/25 Antisense target bmp4.L
chr8S:13732096..13732120 25/25 Antisense target bmp4.S
chr8L:71226880..71226904 25/25 Sense off-target LOC108698759
tropicalis 10.0 Chr8:94980952..94980976 25/25 Antisense target bmp4
Publications
First: Default neural induction: neuralization of dissociated Xenopus cells is mediated by Ras/MAPK activation., Genes Dev 2005  
Most recent: R-spondins are BMP receptor antagonists in Xenopus early embryonic development., Nat Commun 2020                                              
View All Papers