Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249211

Morpholino Name: brca1 MO1
Synonyms: xBRCA1 AS#3
Target mRNA: brca1

Morpholino Type: uncategorized morpholino
Sequence: 5' GTCCTGTCCCTTAAATGCAACTTG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/24
genomic

MO
5' CAAGTTGCATTTAAGGGACAGGTA 3' |||||||||||||||||||||| 3' GTTCAACGTAAATTCCCTGTCCTG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr9_10L:29358637..29358660 22/24 Antisense target brca1.L
chr8L:102869253..102869276 21/24 Sense off-target setdb1.L
chr6S:117226120..117226143 20/24 Antisense off-target ntaq1.S
chr7S:4836363..4836386 20/24 Antisense off-target XB1017155.S [provisional]
chr7S:73061898..73061921 20/24 Sense off-target prpf31.S
chr9_10S:58295497..58295520 20/24 Sense off-target scn1a.S
chr1L:196145572..196145595 20/24 Antisense off-target arl15.L
chr2L:151499952..151499975 20/24 Antisense off-target lima1.L
tropicalis 10.0 Chr3:86192729..86192752 20/24 Sense off-target exoc4
Publications
First: Functional communication between endogenous BRCA1 and its partner, BARD1, during Xenopus laevis development., Proc Natl Acad Sci U S A 2001                  
Most recent:
View All Papers