Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249224

Morpholino Name: c2orf49 MO1
Synonyms: ashwin
Target mRNA: c2orf49

Morpholino Type: uncategorized morpholino
Sequence: 5' AATGGCGAGGGCGCCTCACCCGCTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 24/25
genomic

MO
5' GAGCGGGTGAGGCGCCCTCGCCATT 3' ||||||||||||||||||||||||| 3' CTCGCCCACTCCGCGGGAGCGGTAA 5' 5' GAGCGGGTGAGGCGCCCTCGCCATT 3' ||||||||||||||||||||||||| 3' CTCGCCCACTCCGCGGGAGCGGTAA 5' 5' GAGCGGGTGAGGCGCCCTCACCATT 3' ||||||||||||||||||| ||||| 3' CTCGCCCACTCCGCGGGAGCGGTAA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr2L:110345734..110345758 25/25 Antisense target c2orf49.L
chr2S:93777946..93777970 24/25 Antisense target c2orf49.S
tropicalis 10.0 Chr2:111680012..111680036 25/25 Antisense target c2orf49
Publications
First: Novel gene ashwin functions in Xenopus cell survival and anteroposterior patterning., Dev Dyn 2006                              
Most recent:
View All Papers